Part of scaffold_171 (SequenceType object (1))

For more information consult the page for scaffold_171 (SequenceType object (1))

Potential Gene Matches

The following genes have been identified as possible orthologs in this organism.

Additional orthologs identified in other species via the OPTIC pipeline.

Genome Location

Sequence SequenceType object (2)

Length: 213 bp    Location:51003..49094   Strand:-
>bmy_04960
ATGCTGAGGTTGGCCCCCGCCGTCAGGCTGCTGAAAGCACCCCTGGGGGGCTGGGTGGTCCCCAAGGCACACATCTCCGCCAAGCCAGCCAGAACACCCACTTCTCCAATGGAGCAGGCCATCGGGCTCTCTGTGTTGTTCCTCGGTTTCCTGATTCCTGCAGGCTGGGTCCTGTACCACCTGGAGAGCTATAAGAAGAGCTCCATAGCATGA

Related Sequences

bmy_04960T0 SequenceType object (3)

Length: 71 aa     
>bmy_04960T0
MLRLAPAVRLLKAPLGGWVVPKAHISAKPARTPTSPMEQAIGLSVLFLGFLIPAGWVLYHLESYKKSSIA*